FromConfig adapters

TL;DR: the FromConfig adapters take their data from an array written into config.json, for small datasets or for features an API handed you. There are three: FromConfigAdapter for features, FromConfigSequenceAdapter for sequence, and FromConfigRegionsAdapter for refNames and lengths with no sequence.

FromConfigAdapter

Each entry in features is a feature object. refName, start, end, and a unique uniqueId are required. type, name, and any other attributes are optional, and any extra attribute is readable from a jexl callback. Use it with any feature track type, such as a FeatureTrack:

{
  "type": "FeatureTrack",
  "trackId": "inline_features",
  "name": "Inline features",
  "assemblyNames": ["volvox"],
  "adapter": {
    "type": "FromConfigAdapter",
    "features": [
      {
        "refName": "ctgA",
        "uniqueId": "feature1",
        "start": 190,
        "end": 250,
        "type": "gene",
        "name": "MyGene"
      },
      {
        "refName": "ctgA",
        "uniqueId": "feature2",
        "start": 300,
        "end": 400,
        "type": "mRNA",
        "name": "MyTranscript"
      }
    ]
  }
}

FromConfigSequenceAdapter

A FromConfigAdapter optimized for sequence features, as the adapter of a reference sequence track (see configuring assemblies); each feature's seq holds the bases for its region:

{
  "name": "inline_assembly",
  "sequence": {
    "adapter": {
      "type": "FromConfigSequenceAdapter",
      "features": [
        {
          "refName": "SEQUENCE_1",
          "uniqueId": "firstId",
          "start": 0,
          "end": 33,
          "seq": "CCAAGATCTAAGATGTCAACACCTATCTGCTCA"
        },
        {
          "refName": "SEQUENCE_2",
          "uniqueId": "secondId",
          "start": 0,
          "end": 44,
          "seq": "CCGAACCACAGGCCTATGTTACCATTGGAAAGCTCACCTTCCCG"
        }
      ]
    }
  }
}

FromConfigRegionsAdapter

Supplies refNames and their lengths with no sequence, so a view can be navigated and tracks drawn against an assembly whose FASTA you don't have or don't want to load. Same place in the config as FromConfigSequenceAdapter, and each feature is just an interval:

{
  "name": "regions_only",
  "sequence": {
    "adapter": {
      "type": "FromConfigRegionsAdapter",
      "features": [
        { "uniqueId": "ctgA", "refName": "ctgA", "start": 0, "end": 50000 },
        { "uniqueId": "ctgB", "refName": "ctgB", "start": 0, "end": 6079 }
      ]
    }
  }
}

For the same thing from a file, use a ChromSizesAdapter over a .chrom.sizes.

FromConfig adapters